Skip to main content
Addgene

pFUW-tetO-3xFLAG-GATA2
(Plasmid #125600)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125600 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFUW-tetO
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GATA binding protein 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1443
  • GenBank ID
    NM_001145661.1
  • Entrez Gene
    GATA2 (a.k.a. DCML, IMD21, MONOMAC, NFE1B)
  • Promoter TRE-mCMV
  • Tag / Fusion Protein
    • 3xFLAG tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer TCCACGCTGTTTTGACCTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUW-tetO-3xFLAG-GATA2 was a gift from Filipe Pereira (Addgene plasmid # 125600 ; http://n2t.net/addgene:125600 ; RRID:Addgene_125600)
  • For your References section:

    Cooperative Transcription Factor Induction Mediates Hemogenic Reprogramming. Gomes AM, Kurochkin I, Chang B, Daniel M, Law K, Satija N, Lachmann A, Wang Z, Ferreira L, Ma'ayan A, Chen BK, Papatsenko D, Lemischka IR, Moore KA, Pereira CF. Cell Rep. 2018 Dec 4;25(10):2821-2835.e7. doi: 10.1016/j.celrep.2018.11.032. 10.1016/j.celrep.2018.11.032 PubMed 30517869
OSZAR »