-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 12609 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepH3U3
- Backbone size w/o insert (bp) 5790
-
Vector typeBacterial Expression
-
Selectable markersURA3, HIS3
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMultiple cloning site in His3 Ura3 reporter plasmid
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)44
-
GenBank IDDQ515893
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CAAATATGTATCCGCTCATGAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the cloning information for this plasmid has been corrected as of 1/14/09. The 5' cloning site was changed from MluI to NotI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pH3U3-mcs was a gift from Scot Wolfe (Addgene plasmid # 12609 ; http://n2t.net/addgene:12609 ; RRID:Addgene_12609) -
For your References section:
A bacterial one-hybrid system for determining the DNA-binding specificity of transcription factors. Meng X, Brodsky MH, Wolfe SA. Nat Biotechnol. 2005 Aug . 23(8):988-94. 10.1038/nbt1120 PubMed 16041365