Skip to main content
Addgene

JpExpress404 PTEN-LONG
(Plasmid #49417)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49417 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    JpExpress404
  • Backbone manufacturer
    DNA2.0
  • Backbone size w/o insert (bp) 3968
  • Total vector size (bp) 5793
  • Modifications to backbone
    N/A
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PTEN-Long
  • Entrez Gene
    PTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1)
  • Promoter T5

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer pNI-Rev (CGTTGCTTTTTCGATTGATG)
  • 3′ sequencing primer rrnB_T1_term-F (ACGAAAGGCTCAGTCGAAAG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The PTEN nucleotide sequence in this plasmid has been codon optimized for expression in bacteria.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    JpExpress404 PTEN-LONG was a gift from Ramon Parsons (Addgene plasmid # 49417 ; http://n2t.net/addgene:49417 ; RRID:Addgene_49417)
  • For your References section:

    A secreted PTEN phosphatase that enters cells to alter signaling and survival. Hopkins BD, Fine B, Steinbach N, Dendy M, Rapp Z, Shaw J, Pappas K, Yu JS, Hodakoski C, Mense S, Klein J, Pegno S, Sulis ML, Goldstein H, Amendolara B, Lei L, Maurer M, Bruce J, Canoll P, Hibshoosh H, Parsons R. Science. 2013 Jul 26;341(6144):399-402. doi: 10.1126/science.1234907. Epub 2013 Jun 6. 10.1126/science.1234907 PubMed 23744781
OSZAR »