-
PurposeExpress EGFP-tagged human NLRP3 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73955 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-C2
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 7900
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLR family, pyrin domain containing 3 (NLRP3)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3200
-
GenBank IDNM_004895
-
Entrez GeneNLRP3 (a.k.a. AGTAVPRL, AII, AVP, C1orf7, CIAS1, CLR1.1, DFNA34, FCAS, FCAS1, FCU, KEFH, MWS, NALP3, PYPAF1)
- Promoter CMV iE
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site Sal1 (destroyed during cloning)
- 5′ sequencing primer EGFP-C Sequencing Primer (GGTCCTTCTTGAGTTTGTAAC) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C2-NLRP3 was a gift from Christian Stehlik (Addgene plasmid # 73955 ; http://n2t.net/addgene:73955 ; RRID:Addgene_73955) -
For your References section:
An NLRP7-containing inflammasome mediates recognition of microbial lipopeptides in human macrophages. Khare S, Dorfleutner A, Bryan NB, Yun C, Radian AD, de Almeida L, Rojanasakul Y, Stehlik C. Immunity. 2012 Mar 23;36(3):464-76. doi: 10.1016/j.immuni.2012.02.001. Epub 2012 Feb 21. 10.1016/j.immuni.2012.02.001 PubMed 22361007