Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pEGFP-C2
Information
- Source/Vendor
- Clontech
- Plasmid Type
- Mammalian Expression
- Promoter
- CMV
- Cloning Method
- Unknown
- Size
- 4700
- 5' Sequencing 1 Primer
- EGFP-C
- 5' Sequencing 1 Primer Sequence
- 5'd[CATGGTCCTGCTGGAGTTCGTG]
- Tag 1
- EGFP (Nterm)
- Bacterial Resistance
- Kanamycin
- Selectable Marker
- Neomycin
- Notes
- This plasmid has been discontinued by Clontech. For alternative plasmids with fluorescent tags, try plasmids from Doug Golenbock's Lab (https://www.addgene.org/browse/article/979/) or plasmids from Vladislav Verkhusha's Lab (https://www.addgene.org/browse/pi/1030/articles/).
- Catalog Number
- 6083-1
- Stable
- Stable
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral
Sequence
Published Plasmid Map
