Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pN3
Information
- Source/Vendor
- Guntram Suske
- Plasmid Type
- Mammalian Expression
- Promoter
- CMV
- Cloning Method
- Unknown
- Size
- 3996
- 5' Sequencing 1 Primer
- CMV-F
- 5' Sequencing 1 Primer Sequence
- CGCAAATGGGCGGTAGGCGTG
- Bacterial Resistance
- Kanamycin
- Selectable Marker
- Neomycin
- Notes
- pN3 was constructed by removing the GFP moiety from pEGFP-N3 (Clontech) with BamHI and NotI.
- Catalog Number
- Addgene plasmid 24544
- Stable
- Transient
- Constitutive
- Unspecified
- Viral/Non-Viral
- Nonviral