Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pGMR
Information
- Alt Name
- GMR
- Plasmid Type
- eye expression vector
- Expression Level
- Unknown
- Cloning Method
- Restriction Enzyme
- 5' Sequencing 1 Primer
- GMR P1
- 5' Sequencing 1 Primer Sequence
- CGTCGCTAAGCGAAAGCTAAGCAA
- 5' Terminal
- N-Term
- Notes
- Reference: Development 120, 2121-2129 (1994) https://www.ncbi.nlm.nih.gov/pubmed/7925015 PCR was used to amplify a fragment from construct 29-1 (Ellis et al.,1993). This fragment contains a pentamer of truncated glass-binding sites derived from the Drosophila Rh1 promoter. The primers used to amplify this pentamer and downstream TATA box sequences were ATCGATATCTAGATCTCGAG and GAACTCTGAATAGGGAATTCGGG. These primers contain XhoI and EcoRI sites, respectively, near their 3′ end. PCR products (about 500 bp) were digested with XhoI and EcoRI and ligated into XhoI, EcoRI cut CaSpeR-hs (Pirotta, 1988), thus replacing the HSP 70 promoter and TATA box of CaSpeR-hs with the PCR product derived from construct 29-1. The vector generated is known as pGMR (glass multimer reporter). The expression vector pGMR contains the white marker gene (white), a multimer of glass binding sites (GBS), TATA sequences from the hsp70 promoter (TATA), approximately 200 bases of 5′ untranslated region, a polylinker, and the hsp 70 3′ untranslated region. FlyBase partial sequence for pGMR: http://flybase.org/reports/FBrf0093307.html
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Nonviral